Beetlejuicing - Images

Sorted By:

you're a legend, my dude | /r/beetlejuicing/

. T-Mobile Wi-Fi r/AskReddit u/alpengeist19.5h 1.0k 7:39 PM NSFW People who have drunk breast milk as an adult, what does it taste like? Discussion BEST COMMENTS 550 7 28% ( D ↑ Share datittisucka 4h Ah, one i can answer Its sweet, and warm and drinking a lot of it will leave a sticky coating in the back of your throat. Its almost hard to drink too much of it. I drink it straight from the source. Reply 409 notJooosh • 54m almost 5-year-old account with 1 comment and this is it Vote

. T-Mobile Wi-Fi r/AskReddit u/alpengeist19.5h 1.0k 7:39 PM NSFW People who have drunk breast milk as an adult, what does it taste like? Discussion BEST COMMENTS 550 7 28% ( D ↑ Share datittisucka 4h Ah, one i can answer Its sweet, and warm and drinking a lot of it will leave a sticky coating in the back of your throat. Its almost hard to drink too much of it. I drink it straight from the source. Reply 409 notJooosh • 54m almost 5-year-old account with 1 comment and this is it Vote

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

Rick himself | /r/beetlejuicing/

thebad_comedian . 6y S 17 Awards Will you ever give me up? ReallyRickAstley OP. 6y Really Rick Astley 210 Awards Reply 35k S Go f--- yourself. Ĵ 486.9K

thebad_comedian . 6y S 17 Awards Will you ever give me up? ReallyRickAstley OP. 6y Really Rick Astley 210 Awards Reply 35k S Go f--- yourself. Ĵ 486.9K

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

Holy forking shirt | /r/beetlejuicing/

dognus88 3 hr. ago Holy forking shirt-balls! 207 Reply Share Holy_Forking_Shirt . 2 hr. ago It wouldn't let me use balls in my username. :( Reply Share 13

dognus88 3 hr. ago Holy forking shirt-balls! 207 Reply Share Holy_Forking_Shirt . 2 hr. ago It wouldn't let me use balls in my username. :( Reply Share 13

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

Dr. Science weighs in | /r/beetlejuicing/

BigBean987 5h What other than Snapchat gives messages about screenshots? LilBramwell 2h If you have a Samsung with the S-Pen you can screenshot snapchat without a notification. The S-Pen "Draw Screen" function that takes a screenshot for some reason doesn't trigger any app. yourmomophobe • 1h Phd level horny DrScience-PhD Now Reply 4598 confirmed ✓ Ĵ 163 157 ↓ 2

BigBean987 5h What other than Snapchat gives messages about screenshots? LilBramwell 2h If you have a Samsung with the S-Pen you can screenshot snapchat without a notification. The S-Pen "Draw Screen" function that takes a screenshot for some reason doesn't trigger any app. yourmomophobe • 1h Phd level horny DrScience-PhD Now Reply 4598 confirmed ✓ Ĵ 163 157 ↓ 2

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

On a dad joke about dyslexia | /r/beetlejuicing/

TWNT7. 6h I used to be dyslexic, but now I'm ko Odd_Cantaloupe3923. 1h At the upcoming "Dyslexics of the World Untie" meeting, I can't wait to share this. 4 19 alldyslexicsuntie. 1h Reply 93 Somebody called me? ... ... 412

TWNT7. 6h I used to be dyslexic, but now I'm ko Odd_Cantaloupe3923. 1h At the upcoming "Dyslexics of the World Untie" meeting, I can't wait to share this. 4 19 alldyslexicsuntie. 1h Reply 93 Somebody called me? ... ... 412

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

On a post on AskReddit asking what has a 0% chance of killing you | /r/beetlejuicing/

Raccoon Republic . 5h Seeing uncensored n------. d----n------. 5h You haven't seen my n------... Reply 268 4115

Raccoon Republic . 5h Seeing uncensored n------. d----n------. 5h You haven't seen my n------... Reply 268 4115

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

Antfucker98 | /r/beetlejuicing/

Reply Reply diggledagger 21 hours ago Hob- 1 Stop f------ ants antfucker 98 7 minutes ago no

Reply Reply diggledagger 21 hours ago Hob- 1 Stop f------ ants antfucker 98 7 minutes ago no

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

on a poll about favorite cheeses | /r/beetlejuicing/

. Orange B ← r/polls 379 Stone Doctorate OP 16h I'm feta cuz I like salad 10 01 11:44 326 what did i do? :( 337 ICanDieRightNowPlz. 13h You made the poll and didn't include your favorite cheese? That's ridiculous. Anyway, I hate salad but, I made a ton of them. I love feta. 70 solid_salad 12h ↑ Share Reply Add a comment ICanDieRightNowPlz • 12h . Theoneoddish380 • 11h 100% 123 4 18 We need a metal gear solid parody but this dude as the main character no mo. snake or whatever that guy's name was introducing salad he's solid too

. Orange B ← r/polls 379 Stone Doctorate OP 16h I'm feta cuz I like salad 10 01 11:44 326 what did i do? :( 337 ICanDieRightNowPlz. 13h You made the poll and didn't include your favorite cheese? That's ridiculous. Anyway, I hate salad but, I made a ton of them. I love feta. 70 solid_salad 12h ↑ Share Reply Add a comment ICanDieRightNowPlz • 12h . Theoneoddish380 • 11h 100% 123 4 18 We need a metal gear solid parody but this dude as the main character no mo. snake or whatever that guy's name was introducing salad he's solid too

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

In honor of the return of Futurama | /r/beetlejuicing/

1:14 r/todayilea... Q 6399 456 AltairsBlade . 7h The original party worm You called? ... id Original_Party_Worm. 6h 6 Awards ... ↑ Share 375 570 +

1:14 r/todayilea... Q 6399 456 AltairsBlade . 7h The original party worm You called? ... id Original_Party_Worm. 6h 6 Awards ... ↑ Share 375 570 +

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

I toll-tally dig this one | /r/beetlejuicing/

8:36 ← r/pettyr... 5 CoderJoe1 1 Award You tolled him, didn't you? ⠀ +4.3h You called? 21 ⠀ RupesSax OP. 3h DAMN, I MISSED THE OPPORTUNITY i_toll_for_thee 12m r/beetlejuicing ||| Add a comment Ben_Hocking +3.2h Ask not for whom the road tolls, it tolls for thee. 66 people are here Reply Pyro_vixen. Now ⠀ AusCan531 He tolled him real gud! ⠀ ⠀ NQ5G 47% ● id 2h Sh... 4201 ↓ 493 ↓ 437 + 41 ↓ 1 L 4 11 ✓ 8

8:36 ← r/pettyr... 5 CoderJoe1 1 Award You tolled him, didn't you? ⠀ +4.3h You called? 21 ⠀ RupesSax OP. 3h DAMN, I MISSED THE OPPORTUNITY i_toll_for_thee 12m r/beetlejuicing ||| Add a comment Ben_Hocking +3.2h Ask not for whom the road tolls, it tolls for thee. 66 people are here Reply Pyro_vixen. Now ⠀ AusCan531 He tolled him real gud! ⠀ ⠀ NQ5G 47% ● id 2h Sh... 4201 ↓ 493 ↓ 437 + 41 ↓ 1 L 4 11 ✓ 8

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

That would be kidnapping | /r/beetlejuicing/

alvysinger0412. 12h "Keep twirling your pubes" is one I'm stealing lol Reply 795 Hey! twirlingmypubes 10h ● ... 298

alvysinger0412. 12h "Keep twirling your pubes" is one I'm stealing lol Reply 795 Hey! twirlingmypubes 10h ● ... 298

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

Found on r/lostredditors | /r/beetlejuicing/

alvysinger0412 . 8h "Keep twirling your pubes" is one I'm stealing lol Reply Hey! twirlingmypubes . 7h ... Ĵ 460 161 161

alvysinger0412 . 8h "Keep twirling your pubes" is one I'm stealing lol Reply Hey! twirlingmypubes . 7h ... Ĵ 460 161 161

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

I hate salad | /r/beetlejuicing/

ICanDieRightNowPlz. 4h You made the poll and didn't include your favorite cheese? That's ridiculous. Anyway, I hate salad but, I made a ton of them. I love feta. solid_salad 3h what did i do? :( ... 48 14

ICanDieRightNowPlz. 4h You made the poll and didn't include your favorite cheese? That's ridiculous. Anyway, I hate salad but, I made a ton of them. I love feta. solid_salad 3h what did i do? :( ... 48 14

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

Its like amazon alexa, but for google assistant, i think the cloth hes referring to is the speakers ...

r/googlehome u/Jimmithy Weav. 14h.imgur Anyone else getting holes in their google home fabric for no reason? I have 2 that just randomly appeared IDrinkUrMilksteak • 13h Moths. ... Ashton1241 • 2h Nice try, Moth. Reply Gentlemoth • 3h Moths are gentle and caring creatures that would never do something wrong. ... 69 17

r/googlehome u/Jimmithy Weav. 14h.imgur Anyone else getting holes in their google home fabric for no reason? I have 2 that just randomly appeared IDrinkUrMilksteak • 13h Moths. ... Ashton1241 • 2h Nice try, Moth. Reply Gentlemoth • 3h Moths are gentle and caring creatures that would never do something wrong. ... 69 17

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

Looks like people want your turtle. | /r/beetlejuicing/

AT&T LTE 2.0k 01:00 65 rush47 • 2h I still don't understand how sloths aren't extinct yet Reply Rick-powerfu. 1h The same way turtles aren't Im_a_fuckin_turtle. 1h We can be very quick when properly motivated. oppressed_IT_worker. 1h Add a comment 77% pm_me_ur_demotape. 1h D ↑ Share 82 22 driftinghopelessly. 38m Someone is going to post this to r/ beetlejuicing for a whole 20 upvotes. +1 53

AT&T LTE 2.0k 01:00 65 rush47 • 2h I still don't understand how sloths aren't extinct yet Reply Rick-powerfu. 1h The same way turtles aren't Im_a_fuckin_turtle. 1h We can be very quick when properly motivated. oppressed_IT_worker. 1h Add a comment 77% pm_me_ur_demotape. 1h D ↑ Share 82 22 driftinghopelessly. 38m Someone is going to post this to r/ beetlejuicing for a whole 20 upvotes. +1 53

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

Beetlejuiced across platforms | /r/beetlejuicing/

jimmyisawkward 1 hr. ago Tumanwilhame linux > windows Megamind is unattractive 142.234.12.73 Rule rs_hutch 14h ATGCTCTTAGGTCTAGATCTATGGAACTCATCG vevader_3 14h trans rights ✓ 722 - vevader3 14 min. ago 427 - 1 Award Did you just doxx his genetic sequence 483- That vevader_3 seems really cool and funny and sexy

jimmyisawkward 1 hr. ago Tumanwilhame linux > windows Megamind is unattractive 142.234.12.73 Rule rs_hutch 14h ATGCTCTTAGGTCTAGATCTATGGAACTCATCG vevader_3 14h trans rights ✓ 722 - vevader3 14 min. ago 427 - 1 Award Did you just doxx his genetic sequence 483- That vevader_3 seems really cool and funny and sexy

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes