What Is Going On With 'Meme Coins?' The Cryptocurrency Craze Behind 'Chill Guy,' 'Dogecoin' And 'Pump.Fun' Explained
Where Are They Now? Here's What Kyle Craven, Better Known As The Meme 'Bad Luck Brian,' Has Been Up To Since His 'Advice Animals' Fame
The Weekly Meme Roundup: A Chill Guy, Women In Male-Dominated Fields, Mike Tyson VS. Jake Paul And More
Viral Meme Urges People Not To Google The Name Of The Public Healthcare System Of Brazil
The 'Chill Guy' Meme Finds Its Female Counterpart With 'Just A Chill Girl' Memes

r/googlehome u/Jimmithy Weav. 14h.imgur Anyone else getting holes in their google home fabric for no reason? I have 2 that just randomly appeared IDrinkUrMilksteak • 13h Moths. ... Ashton1241 • 2h Nice try, Moth. Reply Gentlemoth • 3h Moths are gentle and caring creatures that would never do something wrong. ... 69 17

Share Pin Download More

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

Origin Entry: Beetlejuicing

File type: jpg

Resolution: (768px x 768px)

File size: 54.3 KB

1:53 50% 3.2k BEST COMMENTS 307 Share Award AutoModerator ⚫3h ⚫ It looks like this post is about Politics. ... goat-of-mendes • 2h Even his tie turned gray. ◆ Reply 947 Obamas_Tie • 1h 14 Awards Hey man screw you 1.5k gaypornaccount1996 • 1h This is the best username checks out I've ever seen i think ||| O J

UltraLio⚫2h <--- Silly Billy Purple guy is the Knight?!? There's nowhere to run dumbass. Reply 39 ManBehindTheSlauhter ⚫ 2h Goddammit 18

12.2k SwiggetySwoner ⚫4h Oh boy oh boy- Reply 18 SwiggitySwoner123.3h you m-----------, you're the reason I have to put a 123 in my name BEST COMMENTS 42 170 Share Award Madhopper2.3h In still trying to find the person who took the first one of mine MadHopper 31m • Hello there. ◆ Reply 286 271

View All 12,708 Images

More:

Looks like people want your turtle. | /r/beetlejuicing/

AT&T LTE 2.0k 01:00 65 rush47 • 2h I still don't understand how sloths aren't extinct yet Reply Rick-powerfu. 1h The same way turtles aren't Im_a_fuckin_turtle. 1h We can be very quick when properly motivated. oppressed_IT_worker. 1h Add a comment 77% pm_me_ur_demotape. 1h D ↑ Share 82 22 driftinghopelessly. 38m Someone is going to post this to r/ beetlejuicing for a whole 20 upvotes. +1 53

Pin

Beetlejuiced across platforms | /r/beetlejuicing/

jimmyisawkward 1 hr. ago Tumanwilhame linux > windows Megamind is unattractive 142.234.12.73 Rule rs_hutch 14h ATGCTCTTAGGTCTAGATCTATGGAACTCATCG vevader_3 14h trans rights ✓ 722 - vevader3 14 min. ago 427 - 1 Award Did you just doxx his genetic sequence 483- That vevader_3 seems really cool and funny and sexy

Pin

Dad? | /r/beetlejuicing/

LilSisterCumGutters 5h All the work for an ugly uncomfortable p------------? : Reply Defight556 4h 3 Awards That's what my dad used to say to me! imyourrealdad8 1h I never said this. 01 _The_great_papyrus_ 34m r/usernamechecksout ⠀ 889 413 ↑ 36

Pin

Little satisfaction.... | /r/beetlejuicing/

?r/AskReddit u/Acemaster387 • 23h 18 NSFW What went through your head after you lost your virginity? 7313 ↓ 7189 SINGLE COMMENT THREAD Roadhog360 18h Name doesn't check out No_Satisfaction5304 23h H-------- I can't believe we just did that - let's do it again as often as we can manage (and we did) : Reply Little_Satisfaction5 17h At least I have more Share : VIEW ALL 44.5k ↓ 41.3k 4815

Pin

Here’s my contribution | /r/beetlejuicing/

< Replies 10 23:01 WM- Gui• 1d ago He definitely got charged for assault when he tried to use that on someone 748 Self-Improvement • 6h ago Romans 10:9 because, if you confess with your mouth that Jesus is Lord and believe in your heart that God raised him from the dead, you will be saved.1 B 5 Jesus Christ • 5h ago Why is bro taking abt me B7 Soviet Union · 35 min ago @Jesus Christ what a coincidence B1 BooyaBoiBoB. 19 min ago @Jesus Christ Imao B x Add a reply... : : ... :

Pin

Poor gorilla | /r/beetlejuicing/

Not everyone will get this! Would You Rather Be Trapped in a Mall for 24hrs With a Silverback Gorilla or 5 Black Mambas? Mr. Has Sex With Gorillas @ILikeSexWith Gorillas57 Um... I'll pick the gorilla, thanks! ...uh oh! When you notice it! THE GORILLA WHEN IT READS THIS:

Pin

Timmy!! | /r/beetlejuicing/

delicioussparkalade 11 hr. ago Well Timmy...... 1.8k Reply Share TimmysDrumsticks 10 hr. ago You rang? 788 ... Reply Share delicioussparkalade 10 hr. ago I've been waiting years for this. 341 Reply Share... 42 ... ThatsABigHit 6 hr. ago Ahh the Reddit gods reunite two strangers again! 115 Reply Share CedarWolf 4 hr. ago ThatsABigHit We're gonna need another Timmy! Reply Share ... 39 TimmyFarlight 3 hr. ago + I'm here Reply Share :

Pin

He slays the younglings. | /r/beetlejuicing/

6:14 ← r/Funnymemes 4464 Bigdongnathaniel 13h Human flesh isn't that ba- 701 3533 JordonKtulu 13h Alfred Packer has entered the chat : : stangster_monny 12h Jeffrey Dahmer enters the chat SlayerOfChildren 12h I have entered the chat 4 people typing... ||| NQ * 483% Add a comment via GIPHY Share Independent-Walruses 10h Reply ⠀ O This is when the fun begins id 4 556 ↓ Award ↑ 76 ↓ GIF ↑ 91 ↓ < 69 ㄱ 유

Pin

Buck Flizzard. | /r/beetlejuicing/

15:34 ←r/diablo4 F--- blizzard Opinion That is all. 01 an 01 849 or r0pd 7 h • good post Alucard8732 7 h True and real. 165 Willing_Ad_5576 6 h Blizz can MaLIGMA balls ● DoctahDonkey 3 h Buck flizzard Oklmpact2752 7 h • Exactly what I want to say Rocco93693 2 h • Quality post. With you on this one : BuckFlizzard1 1 h Did i Hear my Name? B 96 21 Personen anwesend ||| PlasmaNightSky 43 min I love all of this. Made my damn morning Kommentar hinzufügen ...|| 77% Teilen + Auszeichne O : Antworten 4 13 413 ↓ Voten GIF

Pin

On r/Oddlyterrifying | /r/beetlejuicing/

46474 ↓ 1 Award Well Timmy...... 00 delicioussparkalade • 10h 673 TimmysDrumsticks. 9h 1 Award You rang? ↑ Share + Reply ... G 1.7k 739

Pin

Gehrman Estus'd? Hunter Flasked? | /r/beetlejuicing/

←r/Explain The Joke Last night I 249 your sister a 39 Tenryu003 4h 2: . Likely story Share Redacted Herring 11h Pretty sure it's just supposed to... kragrogg 8h. The guy Gehrmann the first hunter from... estus_flasks 6h I am in no way related to what happened... Reply Award 13

Pin

Beetlejuice is best known for his regular appearances on The Howard Stern Show. | /r/beetlejuicing/

Coffe BEETLEJUICE THE COMPLETE SERIES

Pin

0

Beetlejuicing - Its like amazon alexa, but for google assistant, i think the cloth hes referring to is the speakers | /r/beetlejuicing/

PROTIP: Press the ← and → keys to navigate the gallery, 'g' to view the gallery, or 'r' to view a random image.

r/googlehome u/Jimmithy Weav. 14h.imgur Anyone else getting holes in their google home fabric for no reason? I have 2 that just randomly appeared IDrinkUrMilksteak • 13h Moths. ... Ashton1241 • 2h Nice try, Moth. Reply Gentlemoth • 3h Moths are gentle and caring creatures that would never do something wrong. ... 69 17

View Gallery Random Image

+ Add a Comment

Comments (0)

There are no comments currently available.

Display Comments

Image Details

100 views (10 from today)

Uploaded Jul 21, 2023 at 02:21AM EDT

Origin Entry

Source

Tags

Claim Authorship Edit History

About the Uploader

Reddit Moments

Treasurer & Media Maid

Textile Embed

!https://i.kym-cdn.com/photos/images/newsfeed/002/626/256/48f.jpg!

Today's Top Image Galleries

Everyone I Don't Like Is Hitler

Everyone I Don't Like Is Hitler

My New Character meme.

My New Character / Chill Guy

My Little Pony characters

My Little Pony

Jayce PFP War (Arcane)

Jayce PFP War