BigBean987 5h What other than Snapchat gives messages about screenshots? LilBramwell 2h If you have a Samsung with the S-Pen you can screenshot snapchat without a notification. The S-Pen "Draw Screen" function that takes a screenshot for some reason doesn't trigger any app. yourmomophobe • 1h Phd level horny DrScience-PhD Now Reply 4598 confirmed ✓ Ĵ 163 157 ↓ 2

Share Pin Download More

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

Origin Entry: Beetlejuicing

File type: png

Resolution: (720px x 816px)

File size: 76.5 KB

UN r/funny u/DukeOfHavoc5 • 23m 18 NSFW Boats THE MOST COMMON SEARCH TERMS BY STATE MILF Librarian Asian Lesbian Lesbian Threesome Lesbian hreesome MILF MILF Asian Lesbian MILF Racist BOSM Threesome Asian Asian Droopy Bails Ebony MILF MILF MILF MILF Asian Threesome Lesbian Teen Step MILF Sister Goth Hospital MILF MILF Skin Lesbian MILF Kevin James Step Sister Lesbian Lesbian Ebony Ebony Ebony Lesbian Asian 21 ♡ ☐ 29 ProtoMonkey • 14m "Kevin James"...? P--- hub lamAkevin James • 5m You rang? 22 Reply 12 14

1:53 50% 3.2k BEST COMMENTS 307 Share Award AutoModerator ⚫3h ⚫ It looks like this post is about Politics. ... goat-of-mendes • 2h Even his tie turned gray. ◆ Reply 947 Obamas_Tie • 1h 14 Awards Hey man screw you 1.5k gaypornaccount1996 • 1h This is the best username checks out I've ever seen i think ||| O J

UltraLio⚫2h <--- Silly Billy Purple guy is the Knight?!? There's nowhere to run dumbass. Reply 39 ManBehindTheSlauhter ⚫ 2h Goddammit 18

View All 12,807 Images

More:

On a dad joke about dyslexia | /r/beetlejuicing/

TWNT7. 6h I used to be dyslexic, but now I'm ko Odd_Cantaloupe3923. 1h At the upcoming "Dyslexics of the World Untie" meeting, I can't wait to share this. 4 19 alldyslexicsuntie. 1h Reply 93 Somebody called me? ... ... 412

Pin

On a post on AskReddit asking what has a 0% chance of killing you | /r/beetlejuicing/

Raccoon Republic . 5h Seeing uncensored n------. d----n------. 5h You haven't seen my n------... Reply 268 4115

Pin

Antfucker98 | /r/beetlejuicing/

Reply Reply diggledagger 21 hours ago Hob- 1 Stop f------ ants antfucker 98 7 minutes ago no

Pin

on a poll about favorite cheeses | /r/beetlejuicing/

. Orange B ← r/polls 379 Stone Doctorate OP 16h I'm feta cuz I like salad 10 01 11:44 326 what did i do? :( 337 ICanDieRightNowPlz. 13h You made the poll and didn't include your favorite cheese? That's ridiculous. Anyway, I hate salad but, I made a ton of them. I love feta. 70 solid_salad 12h ↑ Share Reply Add a comment ICanDieRightNowPlz • 12h . Theoneoddish380 • 11h 100% 123 4 18 We need a metal gear solid parody but this dude as the main character no mo. snake or whatever that guy's name was introducing salad he's solid too

Pin

In honor of the return of Futurama | /r/beetlejuicing/

1:14 r/todayilea... Q 6399 456 AltairsBlade . 7h The original party worm You called? ... id Original_Party_Worm. 6h 6 Awards ... ↑ Share 375 570 +

Pin

I toll-tally dig this one | /r/beetlejuicing/

8:36 ← r/pettyr... 5 CoderJoe1 1 Award You tolled him, didn't you? ⠀ +4.3h You called? 21 ⠀ RupesSax OP. 3h DAMN, I MISSED THE OPPORTUNITY i_toll_for_thee 12m r/beetlejuicing ||| Add a comment Ben_Hocking +3.2h Ask not for whom the road tolls, it tolls for thee. 66 people are here Reply Pyro_vixen. Now ⠀ AusCan531 He tolled him real gud! ⠀ ⠀ NQ5G 47% ● id 2h Sh... 4201 ↓ 493 ↓ 437 + 41 ↓ 1 L 4 11 ✓ 8

Pin

That would be kidnapping | /r/beetlejuicing/

alvysinger0412. 12h "Keep twirling your pubes" is one I'm stealing lol Reply 795 Hey! twirlingmypubes 10h ● ... 298

Pin

Found on r/lostredditors | /r/beetlejuicing/

alvysinger0412 . 8h "Keep twirling your pubes" is one I'm stealing lol Reply Hey! twirlingmypubes . 7h ... Ĵ 460 161 161

Pin

I hate salad | /r/beetlejuicing/

ICanDieRightNowPlz. 4h You made the poll and didn't include your favorite cheese? That's ridiculous. Anyway, I hate salad but, I made a ton of them. I love feta. solid_salad 3h what did i do? :( ... 48 14

Pin

Its like amazon alexa, but for google assistant, i think the cloth hes referring to is the speakers | /r/beetlejuicing/

r/googlehome u/Jimmithy Weav. 14h.imgur Anyone else getting holes in their google home fabric for no reason? I have 2 that just randomly appeared IDrinkUrMilksteak • 13h Moths. ... Ashton1241 • 2h Nice try, Moth. Reply Gentlemoth • 3h Moths are gentle and caring creatures that would never do something wrong. ... 69 17

Pin

Looks like people want your turtle. | /r/beetlejuicing/

AT&T LTE 2.0k 01:00 65 rush47 • 2h I still don't understand how sloths aren't extinct yet Reply Rick-powerfu. 1h The same way turtles aren't Im_a_fuckin_turtle. 1h We can be very quick when properly motivated. oppressed_IT_worker. 1h Add a comment 77% pm_me_ur_demotape. 1h D ↑ Share 82 22 driftinghopelessly. 38m Someone is going to post this to r/ beetlejuicing for a whole 20 upvotes. +1 53

Pin

Beetlejuiced across platforms | /r/beetlejuicing/

jimmyisawkward 1 hr. ago Tumanwilhame linux > windows Megamind is unattractive 142.234.12.73 Rule rs_hutch 14h ATGCTCTTAGGTCTAGATCTATGGAACTCATCG vevader_3 14h trans rights ✓ 722 - vevader3 14 min. ago 427 - 1 Award Did you just doxx his genetic sequence 483- That vevader_3 seems really cool and funny and sexy

Pin

0

Beetlejuicing - Dr. Science weighs in | /r/beetlejuicing/

PROTIP: Press the ← and → keys to navigate the gallery, 'g' to view the gallery, or 'r' to view a random image.

BigBean987 5h What other than Snapchat gives messages about screenshots? LilBramwell 2h If you have a Samsung with the S-Pen you can screenshot snapchat without a notification. The S-Pen "Draw Screen" function that takes a screenshot for some reason doesn't trigger any app. yourmomophobe • 1h Phd level horny DrScience-PhD Now Reply 4598 confirmed ✓ Ĵ 163 157 ↓ 2

View Gallery Random Image

+ Add a Comment

Comments (0)

There are no comments currently available.

Display Comments

Image Details

136 views (11 from today)

Uploaded Jul 22, 2023 at 08:22PM EDT

Origin Entry

Source

Tags

Claim Authorship Edit History

About the Uploader

Reddit Moments

Treasurer & Media Maid

Textile Embed

!https://i.kym-cdn.com/photos/images/newsfeed/002/627/256/dbd.png!

Today's Top Image Galleries

Squirrel Girl (Doreen Green)

Squirrel Girl (Doreen Green)

The Amazing Digital Circus title artwork.

The Amazing Digital Circus

Assassination of UnitedHealthcare CEO Brian Thompson depicting an image of the CEO and the gunman.

Assassination of UnitedHealthcare CEO

Lucky Star