The Way iShowSpeed Purses His Lips In His 'Phone GIF' Is More Expressive Than Any Emoji Could Ever Be
'Queen Never Cry': The Ki Sisters Webtoon Panel That Is Spawning Many Memes And Jokes On The Internet
The 'Akakichi No Eleven' Shoulder Grab Was Used For The First Time Exactly A Year Ago
Singer Khalid Comes Out As Gay After X User Outed Him
The Earliest 'Sonichu' Drawing Was Posted On The Internet Two Decades Ago

TWNT7. 6h I used to be dyslexic, but now I'm ko Odd_Cantaloupe3923. 1h At the upcoming "Dyslexics of the World Untie" meeting, I can't wait to share this. 4 19 alldyslexicsuntie. 1h Reply 93 Somebody called me? ... ... 412

Share Pin Download More

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

Origin Entry: Beetlejuicing

File type: jpg

Resolution: (750px x 625px)

File size: 37.7 KB

1:53 50% 3.2k BEST COMMENTS 307 Share Award AutoModerator ⚫3h ⚫ It looks like this post is about Politics. ... goat-of-mendes • 2h Even his tie turned gray. ◆ Reply 947 Obamas_Tie • 1h 14 Awards Hey man screw you 1.5k gaypornaccount1996 • 1h This is the best username checks out I've ever seen i think ||| O J

UltraLio⚫2h <--- Silly Billy Purple guy is the Knight?!? There's nowhere to run dumbass. Reply 39 ManBehindTheSlauhter ⚫ 2h Goddammit 18

12.2k SwiggetySwoner ⚫4h Oh boy oh boy- Reply 18 SwiggitySwoner123.3h you m-----------, you're the reason I have to put a 123 in my name BEST COMMENTS 42 170 Share Award Madhopper2.3h In still trying to find the person who took the first one of mine MadHopper 31m • Hello there. ◆ Reply 286 271

View All 12,722 Images

More:

On a post on AskReddit asking what has a 0% chance of killing you | /r/beetlejuicing/

Raccoon Republic . 5h Seeing uncensored n------. d----n------. 5h You haven't seen my n------... Reply 268 4115

Pin

Antfucker98 | /r/beetlejuicing/

Reply Reply diggledagger 21 hours ago Hob- 1 Stop f------ ants antfucker 98 7 minutes ago no

Pin

on a poll about favorite cheeses | /r/beetlejuicing/

. Orange B ← r/polls 379 Stone Doctorate OP 16h I'm feta cuz I like salad 10 01 11:44 326 what did i do? :( 337 ICanDieRightNowPlz. 13h You made the poll and didn't include your favorite cheese? That's ridiculous. Anyway, I hate salad but, I made a ton of them. I love feta. 70 solid_salad 12h ↑ Share Reply Add a comment ICanDieRightNowPlz • 12h . Theoneoddish380 • 11h 100% 123 4 18 We need a metal gear solid parody but this dude as the main character no mo. snake or whatever that guy's name was introducing salad he's solid too

Pin

In honor of the return of Futurama | /r/beetlejuicing/

1:14 r/todayilea... Q 6399 456 AltairsBlade . 7h The original party worm You called? ... id Original_Party_Worm. 6h 6 Awards ... ↑ Share 375 570 +

Pin

I toll-tally dig this one | /r/beetlejuicing/

8:36 ← r/pettyr... 5 CoderJoe1 1 Award You tolled him, didn't you? ⠀ +4.3h You called? 21 ⠀ RupesSax OP. 3h DAMN, I MISSED THE OPPORTUNITY i_toll_for_thee 12m r/beetlejuicing ||| Add a comment Ben_Hocking +3.2h Ask not for whom the road tolls, it tolls for thee. 66 people are here Reply Pyro_vixen. Now ⠀ AusCan531 He tolled him real gud! ⠀ ⠀ NQ5G 47% ● id 2h Sh... 4201 ↓ 493 ↓ 437 + 41 ↓ 1 L 4 11 ✓ 8

Pin

That would be kidnapping | /r/beetlejuicing/

alvysinger0412. 12h "Keep twirling your pubes" is one I'm stealing lol Reply 795 Hey! twirlingmypubes 10h ● ... 298

Pin

Found on r/lostredditors | /r/beetlejuicing/

alvysinger0412 . 8h "Keep twirling your pubes" is one I'm stealing lol Reply Hey! twirlingmypubes . 7h ... Ĵ 460 161 161

Pin

I hate salad | /r/beetlejuicing/

ICanDieRightNowPlz. 4h You made the poll and didn't include your favorite cheese? That's ridiculous. Anyway, I hate salad but, I made a ton of them. I love feta. solid_salad 3h what did i do? :( ... 48 14

Pin

Its like amazon alexa, but for google assistant, i think the cloth hes referring to is the speakers | /r/beetlejuicing/

r/googlehome u/Jimmithy Weav. 14h.imgur Anyone else getting holes in their google home fabric for no reason? I have 2 that just randomly appeared IDrinkUrMilksteak • 13h Moths. ... Ashton1241 • 2h Nice try, Moth. Reply Gentlemoth • 3h Moths are gentle and caring creatures that would never do something wrong. ... 69 17

Pin

Looks like people want your turtle. | /r/beetlejuicing/

AT&T LTE 2.0k 01:00 65 rush47 • 2h I still don't understand how sloths aren't extinct yet Reply Rick-powerfu. 1h The same way turtles aren't Im_a_fuckin_turtle. 1h We can be very quick when properly motivated. oppressed_IT_worker. 1h Add a comment 77% pm_me_ur_demotape. 1h D ↑ Share 82 22 driftinghopelessly. 38m Someone is going to post this to r/ beetlejuicing for a whole 20 upvotes. +1 53

Pin

Beetlejuiced across platforms | /r/beetlejuicing/

jimmyisawkward 1 hr. ago Tumanwilhame linux > windows Megamind is unattractive 142.234.12.73 Rule rs_hutch 14h ATGCTCTTAGGTCTAGATCTATGGAACTCATCG vevader_3 14h trans rights ✓ 722 - vevader3 14 min. ago 427 - 1 Award Did you just doxx his genetic sequence 483- That vevader_3 seems really cool and funny and sexy

Pin

Dad? | /r/beetlejuicing/

LilSisterCumGutters 5h All the work for an ugly uncomfortable p------------? : Reply Defight556 4h 3 Awards That's what my dad used to say to me! imyourrealdad8 1h I never said this. 01 _The_great_papyrus_ 34m r/usernamechecksout ⠀ 889 413 ↑ 36

Pin

+1

Beetlejuicing - On a dad joke about dyslexia | /r/beetlejuicing/

PROTIP: Press the ← and → keys to navigate the gallery, 'g' to view the gallery, or 'r' to view a random image.

TWNT7. 6h I used to be dyslexic, but now I'm ko Odd_Cantaloupe3923. 1h At the upcoming "Dyslexics of the World Untie" meeting, I can't wait to share this. 4 19 alldyslexicsuntie. 1h Reply 93 Somebody called me? ... ... 412

View Gallery Random Image

+ Add a Comment

Comments (0)

There are no comments currently available.

Display Comments

Image Details

245 views (5 from today)

Uploaded Jul 22, 2023 at 01:22PM EDT

Origin Entry

Source

Tags

Claim Authorship Edit History

About the Uploader

Reddit Moments

Treasurer & Media Maid

Textile Embed

!https://i.kym-cdn.com/photos/images/newsfeed/002/627/127/6ae.jpg!

Today's Top Image Galleries

Queen Never Cry meme.

Queen Never Cry

Wifejak meme format depicting a female wojak character with red hair and a grey shirt.

Wifejak

My New Character meme.

My New Character / Chill Guy

Chris Chan surrounded by lego builds and action figures.

Chris-Chan