Why Are People Calling Patrick Star 'Subaru' On TikTok? The Viral 'SpongeBob' Memes Explained
What's Up With President Trump Defunding 'Transgender Mice' Research? The Origin Of The Viral Debate And Meme Explained
Why Was Content Creator Amouranth The Target Of A Home Invasion? The Attempted Crypto Robbery On The Streamer Explained
What Does 'GM' Mean On TikTok? The Viral 'Dating A GM' Meme Explained
What's The 'My Name Is Edwin' Meme? The 'FNAF Mimic Song' And The Silhouette Of Edwin Murray Explained

8:36 ← r/pettyr... 5 CoderJoe1 1 Award You tolled him, didn't you? ⠀ +4.3h You called? 21 ⠀ RupesSax OP. 3h DAMN, I MISSED THE OPPORTUNITY i_toll_for_thee 12m r/beetlejuicing ||| Add a comment Ben_Hocking +3.2h Ask not for whom the road tolls, it tolls for thee. 66 people are here Reply Pyro_vixen. Now ⠀ AusCan531 He tolled him real gud! ⠀ ⠀ NQ5G 47% ● id 2h Sh... 4201 ↓ 493 ↓ 437 + 41 ↓ 1 L 4 11 ✓ 8

Share Pin Download More

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

Origin Entry: Beetlejuicing

File type: jpg

Resolution: (840px x 2289px)

File size: 116 KB

Guys when they hit 20 but still don't have girlfriends: MAKE AMERICA 27,0k 2.0... 1,6k O AutoModerator ⚫4h ⚫ Did you know we have a Disco... FyouPerryThePlatypus 4h 2004 Why is that platypus wearing a red hat? Y'know.. he looks awfully familiar ← Reply Vote

UN r/funny u/DukeOfHavoc5 • 23m 18 NSFW Boats THE MOST COMMON SEARCH TERMS BY STATE MILF Librarian Asian Lesbian Lesbian Threesome Lesbian hreesome MILF MILF Asian Lesbian MILF Racist BOSM Threesome Asian Asian Droopy Bails Ebony MILF MILF MILF MILF Asian Threesome Lesbian Teen Step MILF Sister Goth Hospital MILF MILF Skin Lesbian MILF Kevin James Step Sister Lesbian Lesbian Ebony Ebony Ebony Lesbian Asian 21 ♡ ☐ 29 ProtoMonkey • 14m "Kevin James"...? P--- hub lamAkevin James • 5m You rang? 22 Reply 12 14

1:53 50% 3.2k BEST COMMENTS 307 Share Award AutoModerator ⚫3h ⚫ It looks like this post is about Politics. ... goat-of-mendes • 2h Even his tie turned gray. ◆ Reply 947 Obamas_Tie • 1h 14 Awards Hey man screw you 1.5k gaypornaccount1996 • 1h This is the best username checks out I've ever seen i think ||| O J

View All 13,017 Images

More:

That would be kidnapping | /r/beetlejuicing/

alvysinger0412. 12h "Keep twirling your pubes" is one I'm stealing lol Reply 795 Hey! twirlingmypubes 10h ● ... 298

Pin

Found on r/lostredditors | /r/beetlejuicing/

alvysinger0412 . 8h "Keep twirling your pubes" is one I'm stealing lol Reply Hey! twirlingmypubes . 7h ... Ĵ 460 161 161

Pin

I hate salad | /r/beetlejuicing/

ICanDieRightNowPlz. 4h You made the poll and didn't include your favorite cheese? That's ridiculous. Anyway, I hate salad but, I made a ton of them. I love feta. solid_salad 3h what did i do? :( ... 48 14

Pin

Its like amazon alexa, but for google assistant, i think the cloth hes referring to is the speakers | /r/beetlejuicing/

r/googlehome u/Jimmithy Weav. 14h.imgur Anyone else getting holes in their google home fabric for no reason? I have 2 that just randomly appeared IDrinkUrMilksteak • 13h Moths. ... Ashton1241 • 2h Nice try, Moth. Reply Gentlemoth • 3h Moths are gentle and caring creatures that would never do something wrong. ... 69 17

Pin

Looks like people want your turtle. | /r/beetlejuicing/

AT&T LTE 2.0k 01:00 65 rush47 • 2h I still don't understand how sloths aren't extinct yet Reply Rick-powerfu. 1h The same way turtles aren't Im_a_fuckin_turtle. 1h We can be very quick when properly motivated. oppressed_IT_worker. 1h Add a comment 77% pm_me_ur_demotape. 1h D ↑ Share 82 22 driftinghopelessly. 38m Someone is going to post this to r/ beetlejuicing for a whole 20 upvotes. +1 53

Pin

Beetlejuiced across platforms | /r/beetlejuicing/

jimmyisawkward 1 hr. ago Tumanwilhame linux > windows Megamind is unattractive 142.234.12.73 Rule rs_hutch 14h ATGCTCTTAGGTCTAGATCTATGGAACTCATCG vevader_3 14h trans rights ✓ 722 - vevader3 14 min. ago 427 - 1 Award Did you just doxx his genetic sequence 483- That vevader_3 seems really cool and funny and sexy

Pin

Dad? | /r/beetlejuicing/

LilSisterCumGutters 5h All the work for an ugly uncomfortable p------------? : Reply Defight556 4h 3 Awards That's what my dad used to say to me! imyourrealdad8 1h I never said this. 01 _The_great_papyrus_ 34m r/usernamechecksout ⠀ 889 413 ↑ 36

Pin

Little satisfaction.... | /r/beetlejuicing/

?r/AskReddit u/Acemaster387 • 23h 18 NSFW What went through your head after you lost your virginity? 7313 ↓ 7189 SINGLE COMMENT THREAD Roadhog360 18h Name doesn't check out No_Satisfaction5304 23h H-------- I can't believe we just did that - let's do it again as often as we can manage (and we did) : Reply Little_Satisfaction5 17h At least I have more Share : VIEW ALL 44.5k ↓ 41.3k 4815

Pin

Here’s my contribution | /r/beetlejuicing/

< Replies 10 23:01 WM- Gui• 1d ago He definitely got charged for assault when he tried to use that on someone 748 Self-Improvement • 6h ago Romans 10:9 because, if you confess with your mouth that Jesus is Lord and believe in your heart that God raised him from the dead, you will be saved.1 B 5 Jesus Christ • 5h ago Why is bro taking abt me B7 Soviet Union · 35 min ago @Jesus Christ what a coincidence B1 BooyaBoiBoB. 19 min ago @Jesus Christ Imao B x Add a reply... : : ... :

Pin

Poor gorilla | /r/beetlejuicing/

Not everyone will get this! Would You Rather Be Trapped in a Mall for 24hrs With a Silverback Gorilla or 5 Black Mambas? Mr. Has Sex With Gorillas @ILikeSexWith Gorillas57 Um... I'll pick the gorilla, thanks! ...uh oh! When you notice it! THE GORILLA WHEN IT READS THIS:

Pin

Timmy!! | /r/beetlejuicing/

delicioussparkalade 11 hr. ago Well Timmy...... 1.8k Reply Share TimmysDrumsticks 10 hr. ago You rang? 788 ... Reply Share delicioussparkalade 10 hr. ago I've been waiting years for this. 341 Reply Share... 42 ... ThatsABigHit 6 hr. ago Ahh the Reddit gods reunite two strangers again! 115 Reply Share CedarWolf 4 hr. ago ThatsABigHit We're gonna need another Timmy! Reply Share ... 39 TimmyFarlight 3 hr. ago + I'm here Reply Share :

Pin

He slays the younglings. | /r/beetlejuicing/

6:14 ← r/Funnymemes 4464 Bigdongnathaniel 13h Human flesh isn't that ba- 701 3533 JordonKtulu 13h Alfred Packer has entered the chat : : stangster_monny 12h Jeffrey Dahmer enters the chat SlayerOfChildren 12h I have entered the chat 4 people typing... ||| NQ * 483% Add a comment via GIPHY Share Independent-Walruses 10h Reply ⠀ O This is when the fun begins id 4 556 ↓ Award ↑ 76 ↓ GIF ↑ 91 ↓ < 69 ㄱ 유

Pin

0

Beetlejuicing - I toll-tally dig this one | /r/beetlejuicing/

PROTIP: Press the ← and → keys to navigate the gallery, 'g' to view the gallery, or 'r' to view a random image.

8:36 ← r/pettyr... 5 CoderJoe1 1 Award You tolled him, didn't you? ⠀ +4.3h You called? 21 ⠀ RupesSax OP. 3h DAMN, I MISSED THE OPPORTUNITY i_toll_for_thee 12m r/beetlejuicing ||| Add a comment Ben_Hocking +3.2h Ask not for whom the road tolls, it tolls for thee. 66 people are here Reply Pyro_vixen. Now ⠀ AusCan531 He tolled him real gud! ⠀ ⠀ NQ5G 47% ● id 2h Sh... 4201 ↓ 493 ↓ 437 + 41 ↓ 1 L 4 11 ✓ 8

View Gallery Random Image

+ Add a Comment

Comments (0)

There are no comments currently available.

Display Comments

Image Details

74 views (5 from today)

Uploaded Jul 22, 2023 at 12:22AM EDT

Origin Entry

Source

Tags

Claim Authorship Edit History

About the Uploader

Reddit Moments

Treasurer & Media Maid

Textile Embed

!https://i.kym-cdn.com/photos/images/newsfeed/002/626/868/3ca.jpg!

Today's Top Image Galleries

Spooky Pokemon trainer

Hex Maniac

JD Vance Babyface Edits meme examples.

J.D. Vance Babyface Edits

JD Vance Have You Said Thank You Once meme example.

"Have You Said Thank You Once?"

Woll Smoth