Beetlejuicing - Images

Sorted By:

Holy forking shirt | /r/beetlejuicing/

dognus88 3 hr. ago Holy forking shirt-balls! 207 Reply Share Holy_Forking_Shirt . 2 hr. ago It wouldn't let me use balls in my username. :( Reply Share 13

dognus88 3 hr. ago Holy forking shirt-balls! 207 Reply Share Holy_Forking_Shirt . 2 hr. ago It wouldn't let me use balls in my username. :( Reply Share 13

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

Dr. Science weighs in | /r/beetlejuicing/

BigBean987 5h What other than Snapchat gives messages about screenshots? LilBramwell 2h If you have a Samsung with the S-Pen you can screenshot snapchat without a notification. The S-Pen "Draw Screen" function that takes a screenshot for some reason doesn't trigger any app. yourmomophobe • 1h Phd level horny DrScience-PhD Now Reply 4598 confirmed ✓ Ĵ 163 157 ↓ 2

BigBean987 5h What other than Snapchat gives messages about screenshots? LilBramwell 2h If you have a Samsung with the S-Pen you can screenshot snapchat without a notification. The S-Pen "Draw Screen" function that takes a screenshot for some reason doesn't trigger any app. yourmomophobe • 1h Phd level horny DrScience-PhD Now Reply 4598 confirmed ✓ Ĵ 163 157 ↓ 2

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

On a dad joke about dyslexia | /r/beetlejuicing/

TWNT7. 6h I used to be dyslexic, but now I'm ko Odd_Cantaloupe3923. 1h At the upcoming "Dyslexics of the World Untie" meeting, I can't wait to share this. 4 19 alldyslexicsuntie. 1h Reply 93 Somebody called me? ... ... 412

TWNT7. 6h I used to be dyslexic, but now I'm ko Odd_Cantaloupe3923. 1h At the upcoming "Dyslexics of the World Untie" meeting, I can't wait to share this. 4 19 alldyslexicsuntie. 1h Reply 93 Somebody called me? ... ... 412

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

On a post on AskReddit asking what has a 0% chance of killing you | /r/beetlejuicing/

Raccoon Republic . 5h Seeing uncensored n------. d----n------. 5h You haven't seen my n------... Reply 268 4115

Raccoon Republic . 5h Seeing uncensored n------. d----n------. 5h You haven't seen my n------... Reply 268 4115

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

Antfucker98 | /r/beetlejuicing/

Reply Reply diggledagger 21 hours ago Hob- 1 Stop f------ ants antfucker 98 7 minutes ago no

Reply Reply diggledagger 21 hours ago Hob- 1 Stop f------ ants antfucker 98 7 minutes ago no

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

on a poll about favorite cheeses | /r/beetlejuicing/

. Orange B ← r/polls 379 Stone Doctorate OP 16h I'm feta cuz I like salad 10 01 11:44 326 what did i do? :( 337 ICanDieRightNowPlz. 13h You made the poll and didn't include your favorite cheese? That's ridiculous. Anyway, I hate salad but, I made a ton of them. I love feta. 70 solid_salad 12h ↑ Share Reply Add a comment ICanDieRightNowPlz • 12h . Theoneoddish380 • 11h 100% 123 4 18 We need a metal gear solid parody but this dude as the main character no mo. snake or whatever that guy's name was introducing salad he's solid too

. Orange B ← r/polls 379 Stone Doctorate OP 16h I'm feta cuz I like salad 10 01 11:44 326 what did i do? :( 337 ICanDieRightNowPlz. 13h You made the poll and didn't include your favorite cheese? That's ridiculous. Anyway, I hate salad but, I made a ton of them. I love feta. 70 solid_salad 12h ↑ Share Reply Add a comment ICanDieRightNowPlz • 12h . Theoneoddish380 • 11h 100% 123 4 18 We need a metal gear solid parody but this dude as the main character no mo. snake or whatever that guy's name was introducing salad he's solid too

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

In honor of the return of Futurama | /r/beetlejuicing/

1:14 r/todayilea... Q 6399 456 AltairsBlade . 7h The original party worm You called? ... id Original_Party_Worm. 6h 6 Awards ... ↑ Share 375 570 +

1:14 r/todayilea... Q 6399 456 AltairsBlade . 7h The original party worm You called? ... id Original_Party_Worm. 6h 6 Awards ... ↑ Share 375 570 +

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

I toll-tally dig this one | /r/beetlejuicing/

8:36 ← r/pettyr... 5 CoderJoe1 1 Award You tolled him, didn't you? ⠀ +4.3h You called? 21 ⠀ RupesSax OP. 3h DAMN, I MISSED THE OPPORTUNITY i_toll_for_thee 12m r/beetlejuicing ||| Add a comment Ben_Hocking +3.2h Ask not for whom the road tolls, it tolls for thee. 66 people are here Reply Pyro_vixen. Now ⠀ AusCan531 He tolled him real gud! ⠀ ⠀ NQ5G 47% ● id 2h Sh... 4201 ↓ 493 ↓ 437 + 41 ↓ 1 L 4 11 ✓ 8

8:36 ← r/pettyr... 5 CoderJoe1 1 Award You tolled him, didn't you? ⠀ +4.3h You called? 21 ⠀ RupesSax OP. 3h DAMN, I MISSED THE OPPORTUNITY i_toll_for_thee 12m r/beetlejuicing ||| Add a comment Ben_Hocking +3.2h Ask not for whom the road tolls, it tolls for thee. 66 people are here Reply Pyro_vixen. Now ⠀ AusCan531 He tolled him real gud! ⠀ ⠀ NQ5G 47% ● id 2h Sh... 4201 ↓ 493 ↓ 437 + 41 ↓ 1 L 4 11 ✓ 8

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

That would be kidnapping | /r/beetlejuicing/

alvysinger0412. 12h "Keep twirling your pubes" is one I'm stealing lol Reply 795 Hey! twirlingmypubes 10h ● ... 298

alvysinger0412. 12h "Keep twirling your pubes" is one I'm stealing lol Reply 795 Hey! twirlingmypubes 10h ● ... 298

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

Found on r/lostredditors | /r/beetlejuicing/

alvysinger0412 . 8h "Keep twirling your pubes" is one I'm stealing lol Reply Hey! twirlingmypubes . 7h ... Ĵ 460 161 161

alvysinger0412 . 8h "Keep twirling your pubes" is one I'm stealing lol Reply Hey! twirlingmypubes . 7h ... Ĵ 460 161 161

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

I hate salad | /r/beetlejuicing/

ICanDieRightNowPlz. 4h You made the poll and didn't include your favorite cheese? That's ridiculous. Anyway, I hate salad but, I made a ton of them. I love feta. solid_salad 3h what did i do? :( ... 48 14

ICanDieRightNowPlz. 4h You made the poll and didn't include your favorite cheese? That's ridiculous. Anyway, I hate salad but, I made a ton of them. I love feta. solid_salad 3h what did i do? :( ... 48 14

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

Its like amazon alexa, but for google assistant, i think the cloth hes referring to is the speakers | /r/beetlejuicing/

r/googlehome u/Jimmithy Weav. 14h.imgur Anyone else getting holes in their google home fabric for no reason? I have 2 that just randomly appeared IDrinkUrMilksteak • 13h Moths. ... Ashton1241 • 2h Nice try, Moth. Reply Gentlemoth • 3h Moths are gentle and caring creatures that would never do something wrong. ... 69 17

r/googlehome u/Jimmithy Weav. 14h.imgur Anyone else getting holes in their google home fabric for no reason? I have 2 that just randomly appeared IDrinkUrMilksteak • 13h Moths. ... Ashton1241 • 2h Nice try, Moth. Reply Gentlemoth • 3h Moths are gentle and caring creatures that would never do something wrong. ... 69 17

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

Looks like people want your turtle. | /r/beetlejuicing/

AT&T LTE 2.0k 01:00 65 rush47 • 2h I still don't understand how sloths aren't extinct yet Reply Rick-powerfu. 1h The same way turtles aren't Im_a_fuckin_turtle. 1h We can be very quick when properly motivated. oppressed_IT_worker. 1h Add a comment 77% pm_me_ur_demotape. 1h D ↑ Share 82 22 driftinghopelessly. 38m Someone is going to post this to r/ beetlejuicing for a whole 20 upvotes. +1 53

AT&T LTE 2.0k 01:00 65 rush47 • 2h I still don't understand how sloths aren't extinct yet Reply Rick-powerfu. 1h The same way turtles aren't Im_a_fuckin_turtle. 1h We can be very quick when properly motivated. oppressed_IT_worker. 1h Add a comment 77% pm_me_ur_demotape. 1h D ↑ Share 82 22 driftinghopelessly. 38m Someone is going to post this to r/ beetlejuicing for a whole 20 upvotes. +1 53

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

Beetlejuiced across platforms | /r/beetlejuicing/

jimmyisawkward 1 hr. ago Tumanwilhame linux > windows Megamind is unattractive 142.234.12.73 Rule rs_hutch 14h ATGCTCTTAGGTCTAGATCTATGGAACTCATCG vevader_3 14h trans rights ✓ 722 - vevader3 14 min. ago 427 - 1 Award Did you just doxx his genetic sequence 483- That vevader_3 seems really cool and funny and sexy

jimmyisawkward 1 hr. ago Tumanwilhame linux > windows Megamind is unattractive 142.234.12.73 Rule rs_hutch 14h ATGCTCTTAGGTCTAGATCTATGGAACTCATCG vevader_3 14h trans rights ✓ 722 - vevader3 14 min. ago 427 - 1 Award Did you just doxx his genetic sequence 483- That vevader_3 seems really cool and funny and sexy

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

Dad? | /r/beetlejuicing/

LilSisterCumGutters 5h All the work for an ugly uncomfortable p------------? : Reply Defight556 4h 3 Awards That's what my dad used to say to me! imyourrealdad8 1h I never said this. 01 _The_great_papyrus_ 34m r/usernamechecksout ⠀ 889 413 ↑ 36

LilSisterCumGutters 5h All the work for an ugly uncomfortable p------------? : Reply Defight556 4h 3 Awards That's what my dad used to say to me! imyourrealdad8 1h I never said this. 01 _The_great_papyrus_ 34m r/usernamechecksout ⠀ 889 413 ↑ 36

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

Little satisfaction.... | /r/beetlejuicing/

?r/AskReddit u/Acemaster387 • 23h 18 NSFW What went through your head after you lost your virginity? 7313 ↓ 7189 SINGLE COMMENT THREAD Roadhog360 18h Name doesn't check out No_Satisfaction5304 23h H-------- I can't believe we just did that - let's do it again as often as we can manage (and we did) : Reply Little_Satisfaction5 17h At least I have more Share : VIEW ALL 44.5k ↓ 41.3k 4815

?r/AskReddit u/Acemaster387 • 23h 18 NSFW What went through your head after you lost your virginity? 7313 ↓ 7189 SINGLE COMMENT THREAD Roadhog360 18h Name doesn't check out No_Satisfaction5304 23h H-------- I can't believe we just did that - let's do it again as often as we can manage (and we did) : Reply Little_Satisfaction5 17h At least I have more Share : VIEW ALL 44.5k ↓ 41.3k 4815

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

Here’s my contribution | /r/beetlejuicing/

< Replies 10 23:01 WM- Gui• 1d ago He definitely got charged for assault when he tried to use that on someone 748 Self-Improvement • 6h ago Romans 10:9 because, if you confess with your mouth that Jesus is Lord and believe in your heart that God raised him from the dead, you will be saved.1 B 5 Jesus Christ • 5h ago Why is bro taking abt me B7 Soviet Union · 35 min ago @Jesus Christ what a coincidence B1 BooyaBoiBoB. 19 min ago @Jesus Christ Imao B x Add a reply... : : ... :

< Replies 10 23:01 WM- Gui• 1d ago He definitely got charged for assault when he tried to use that on someone 748 Self-Improvement • 6h ago Romans 10:9 because, if you confess with your mouth that Jesus is Lord and believe in your heart that God raised him from the dead, you will be saved.1 B 5 Jesus Christ • 5h ago Why is bro taking abt me B7 Soviet Union · 35 min ago @Jesus Christ what a coincidence B1 BooyaBoiBoB. 19 min ago @Jesus Christ Imao B x Add a reply... : : ... :

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

Poor gorilla | /r/beetlejuicing/

Not everyone will get this! Would You Rather Be Trapped in a Mall for 24hrs With a Silverback Gorilla or 5 Black Mambas? Mr. Has Sex With Gorillas @ILikeSexWith Gorillas57 Um... I'll pick the gorilla, thanks! ...uh oh! When you notice it! THE GORILLA WHEN IT READS THIS:

Not everyone will get this! Would You Rather Be Trapped in a Mall for 24hrs With a Silverback Gorilla or 5 Black Mambas? Mr. Has Sex With Gorillas @ILikeSexWith Gorillas57 Um... I'll pick the gorilla, thanks! ...uh oh! When you notice it! THE GORILLA WHEN IT READS THIS:

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

Timmy!! | /r/beetlejuicing/

delicioussparkalade 11 hr. ago Well Timmy...... 1.8k Reply Share TimmysDrumsticks 10 hr. ago You rang? 788 ... Reply Share delicioussparkalade 10 hr. ago I've been waiting years for this. 341 Reply Share... 42 ... ThatsABigHit 6 hr. ago Ahh the Reddit gods reunite two strangers again! 115 Reply Share CedarWolf 4 hr. ago ThatsABigHit We're gonna need another Timmy! Reply Share ... 39 TimmyFarlight 3 hr. ago + I'm here Reply Share :

delicioussparkalade 11 hr. ago Well Timmy...... 1.8k Reply Share TimmysDrumsticks 10 hr. ago You rang? 788 ... Reply Share delicioussparkalade 10 hr. ago I've been waiting years for this. 341 Reply Share... 42 ... ThatsABigHit 6 hr. ago Ahh the Reddit gods reunite two strangers again! 115 Reply Share CedarWolf 4 hr. ago ThatsABigHit We're gonna need another Timmy! Reply Share ... 39 TimmyFarlight 3 hr. ago + I'm here Reply Share :

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

He slays the younglings. | /r/beetlejuicing/

6:14 ← r/Funnymemes 4464 Bigdongnathaniel 13h Human flesh isn't that ba- 701 3533 JordonKtulu 13h Alfred Packer has entered the chat : : stangster_monny 12h Jeffrey Dahmer enters the chat SlayerOfChildren 12h I have entered the chat 4 people typing... ||| NQ * 483% Add a comment via GIPHY Share Independent-Walruses 10h Reply ⠀ O This is when the fun begins id 4 556 ↓ Award ↑ 76 ↓ GIF ↑ 91 ↓ < 69 ㄱ 유

6:14 ← r/Funnymemes 4464 Bigdongnathaniel 13h Human flesh isn't that ba- 701 3533 JordonKtulu 13h Alfred Packer has entered the chat : : stangster_monny 12h Jeffrey Dahmer enters the chat SlayerOfChildren 12h I have entered the chat 4 people typing... ||| NQ * 483% Add a comment via GIPHY Share Independent-Walruses 10h Reply ⠀ O This is when the fun begins id 4 556 ↓ Award ↑ 76 ↓ GIF ↑ 91 ↓ < 69 ㄱ 유

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes